الرئيسيةالرئيسية  اليوميةاليومية  س .و .جس .و .ج  بحـثبحـث  قائمة الاعضاءقائمة الاعضاء  المجموعاتالمجموعات  التسجيلالتسجيل  دخولدخول  
  حفظ البيانات؟
  





 
اخر مواضيع المنتدى
تاريخ ارسال المشاركة
بواسطة
السبت يونيو 25, 2016 5:10 pm
الإثنين مارس 28, 2016 6:12 pm
الأربعاء مارس 02, 2016 4:32 pm
الإثنين فبراير 08, 2016 1:29 pm
الثلاثاء ديسمبر 22, 2015 4:53 pm
الإثنين فبراير 02, 2015 8:47 pm
السبت مارس 22, 2014 3:57 pm
السبت مارس 22, 2014 11:04 am
السبت مارس 22, 2014 11:01 am
السبت مارس 22, 2014 10:58 am
ايما تيم
ايما تيم
ايما تيم
ايما تيم
ايما تيم
saidyazid
الزعيم
الزعيم
الزعيم
الزعيم

شاطر | 
كاتب الموضوعرسالة
معلومات العضو



Admin
معلومات إضافية
ذكر
عدد المساهمات : 929
تاريخ التسجيل : 04/01/2013
العمر : 26
معلومات الاتصال
معاينة صفحة البيانات الشخصي للعضو http://egytoday.123.st
مُساهمةموضوع: مفهوم البرنامج الوراثي والمورثة الأربعاء فبراير 06, 2013 10:43 pm





البرنامج الوراثي والمورّثة

الفهرس:

1. مقدمة.
2. الوراثة الماندليّة وبعض المفاهيم الوراثيّة
3. متى تم اكتشاف المورثات؟ من أول من بدأ بدراستها؟؟
4. مفهوم الصنوة"الأليل" Allele :
5. ما هي أولى تجارب ماندل؟
6. السيادة المشتركة – الرجحان المشترك..
7. ما هي الطبيعة الكيميائية للمورثة؟
8. أين تقع المورثات؟
9. كم عدد المورثات في كائن حي أو في خلية حية؟
10. ما هو طول (حجم) المورثة الواحدة؟
11. برنامج الهندسة الوراثية.
12. ميزات الهندسة الوراثية(الايجابيات والسلبيات)
13. كيف تتواجد المورثات فيجسم الكائن؟ وأين؟ ووفق أي تراتبية؟
14. كيف يتم التعبير عن المورثة (التعبير المورثي.التعبير الظاهري)
15. كيف تترجم المورثة الى صفة ظاهرة.
16. ماهي العوامل التي قد تغير من المورثة(تغيير النمط الظاهري)
17. ما هو تأثير تغير المعلومات الوراثية على مستوى المورثة؟
18. الخاتمة
______

المقدمة :

قال الله تعالى (يَا أَيُّهَا النَّاسُ ضُرِبَ مَثَلٌ فَاسْتَمِعُوا لَهُ إِنَّ الَّذِينَ تَدْعُونَ مِن دُونِ اللَّهِ لَن يَخْلُقُوا ذُبَابًا وَلَوِ اجْتَمَعُوا لَهُ وَإِن يَسْلُبْهُمُ الذُّبَابُ شَيْئًا لَّا يَسْتَنقِذُوهُ مِنْهُ ضَعُفَ الطَّالِبُ وَالْمَطْلُوبُ)(سورة الحج:73).
----------------------------------------------------
الهندسة الوراثية أو ما يعرف أحيانًا بهندسة((الجينات)) الوراثية هي أحدث الطرق العلمية في تغيير التركيب الجيني والتحكم في الصفات الوراثية للكائن الحي(نبات - حيوان - إنسان).وسيتناول بحثنا تلخيص برامج الهندسة الوراثية ، ومميزاتها ، وتطبيق لها على المجال الطبي وأخطار تطبيقات تقنيات الهندسة الوراثية على البيئة .
______

الوراثة الماندليّة وبعض المفاهيم الوراثيّة:

كثيراً ما نتساءل عن صفاتنا عندما ننظر إلى نفسنا في المرآة، بعضنا بعيون زرقاء، وبعضنا عيونه خضراء، والكثير من الصفات التي لا نعرف مصدرها.. ولا نعرف لم نحن هكذا بالتحديد..

علم الوراثة هو العلم الوحيد القادر على تفسير هذه الصفات، ومعرفة مصدرها.. ولنعي تماماً المعلومات الوراثية، لا بدَّ أن نحيط بالعديد من الأفكار الأساسية، ومن ثم ننتقل إلى المعلومات الاختصاصية... فلنبدأ !
______

ومتى تم اكتشاف المورثات؟ من أول من بدأ بدراستها؟؟:

اكتشاف المورثات Discovery Of Genes إن أول من فكر بوجود عوامل مسؤولة عن إظهار الصفات هو العالم والراهب النمساوي غريغور جوهان ماندل Gregor Johan Mendel الذي أجرى بحوثه على نبات البازلاء peas حيث كانت باكورة اكتشافاته ما يلي :

هناك عوامل خاصة Particular Factors تنقل الصفات من الآباء إلى باقي الذرية دون أن يطرأ عليها أي تغيير، وتنتقل تلك العوامل عن طريق عملية الإلقاح التي تتم بين غبار الطلع والبيوض النباتية Ovules لإنتاج أفراد جديدة.

مبدأ ماندل الأول، مبدأ استقلال الصفات :

لقد وصف ماندل – وبشكل مبدئي – أن المورثات لا تؤثر على بعضها خلال عملية التعبير.
وبعبارة أخرى، تنتقل المورثة من جيل لآخر بشكل مستقل عن المورثات الأخرى، فتحاول التعبير عن نفسها عندما تتواجد، وذلك دون وجود علاقات مع المورثات الأخرى.

الجدير بالذكر أن قانون ماندل كان صحيحاً حتى وقت معين، حيث اكتشف ارتباط بعض المورثات ببعضها، وتوضح مفهوم "الارتباط المورثي" الذي سنتكلم عنه فيما بعد.


كيف يمكننا التوفيق بين مفهوم المورثة وعدة أنماط ظاهرية من أجل صفة واحدة؟
_____

مفهوم الصنوة Allele ::

لا بد من معرفة أن المورثة هي عبارة عن مصطلح يَضم في طياته أكثر من شكلاً مورثياً ليعطي أكثر من نمط ظاهري من أجل نفس الصفة المسؤولة عنها تلك المورثة.
لنأخذ مثالاً للتوضيح، ففي صفة لون بذور نبات البازلاء ، لماذا هناك بذرة خضراء، وبذرة صفراء ؟؟؟
ذلك لأن المورثة المسؤولة عن إظهار لون البذرة لها أكثر من شكل، وكل شكل اسمه "صنوة" حيث هناك صنوة تمنح البذرة لونها الأصفر، وصنوة مختلفة تماماً تمنح البذرة لونها الأخضر.

وبالتالي، فظهور لون معين للبذور محدَّد بتقابل صنوتين (الصيغة المضاعفة) لمورثة لون البذور، إحدى الصنوتين على الصبغي الأبوي (من الأب) والصنوة الأخرى على الصبغي الأموي (من الأم – الأب الآخر.)


ما الذي يحدد الصنوات المتقابلة لصفة معينة؟ وهل تتماثل الصنوتان المتقابلتان أم تختلفان؟

لنفكر قليلاً، من الممكن أن تكون الصنوتين المتقابلتين متماثلتين، ومن الممكن أيضاً أن تكونا مختلفتين.. لذا، فذلك يخلق لدينا مفهوماً جديداً حول ما يسمى بالفرد متماثل اللواقح والفرد متخالف اللواقح...

الفرد المتماثل اللواقح Homozygous : حيث تكون الصنوتان المتاقبلتان لمورثة معين متماثلتان، والنمط الظاهري لا شك فيه ولا خلاف.. ولا حاجة لأي قانون أو مفهوم وراثي لمعرفة النمط الظاهري، فإذا كانت الصنوتان مسؤولتان عن إظهار لون البذور الأخضر، فحتماً سيكون لون البذور أخضر.

الفرد متخالف اللواقح Heterozygous : حيث تكون الصنوتان المتقابلتان لمورثة معينة مختلفتان، أي لا يمكن معرفة الصفة الظاهرة إلا بمعرفة الصنوة الأرجح، أو حتى معرفة الطريقة التي تظهر من خلالها الصفة.
_______________

ما هي أولى تجارب ماندل؟

قبل ذلك، لا بد من الإشارة إلى أن الفرد متماثل اللواقح - بالنسبة لصفة معينة - هو من سلالة صافية، والفرد متخالف اللواقح - بالنسبة لصفة معينة – من سلالة غير صافية (هجينة).

أجرى ماندل أولى تجاربه دارساً صفة لون البذور عند نبات البازلاء وفق ما يلي :
أحضر مناندل فردي بازلاء، الفرد الأول أخضر البذور من سلالة صافية (أي متماثل اللواقح)، والفرد الآخر أصفر البذور من سلالة صافية (أي متماثل اللواقح ).. فكان الأفراد الناتجون ذوي بذور صفراء متخالفي اللواقح! (بحسب اكتشاف ماندل).
_______________

لماذا كانت البذور الناتجة صفراء وليست خضراء مثلاً؟ أي ما الذي يحدد النمط الظاهري حالة الفرد متخالف اللواقح بالنسبة لصفة معينة؟

إن ذلك لا يحدد بقانون ثابت، فهناك أكثر من قانون يحكم ظهور نمط ظاهري معين لصفة ما، وذلك بالطبع بحسب المورثة.. وللتوضيح لا بد من معرفة مبدأي السيادة التامة والسيادة المشتركة.

السيادة التامة Complete Dominance - الرجحان التام :

إن لذلك التعبير أهمية كبيرة في فهم النمط الظاهري لفرد متخالف اللواقح (الصنوات)، حيث يعني مفهوم السيادة التامة، سيادة إحدى الصنوتين على الصنوة الأخرى المقابلة، وحينها يكون النمط الظاهري وفقاً للصنوة الأرجح (الأقوى - السائدة) أما الصنوة الأخرى فهي موجودة لكن دون أن تعبر عن نفسها أبداً.

و لنعد إلى تجربة ماندل حول لون البذور، فإن الأفراد الناتجين عن التزاوج هم ببذور صفراء، ونمطهم المورثي متخالف اللواقح (صفراء- خضراء)، إذاً "صنوة لون البذور الأصفر هي الراجحة دون أدنى شك".

السيادة غير التامة (المشتركة Incomplete Dominance – )الرجحان المشترك :

ولهذا التعبير أيضاً أهمية كبيرة في تفسير بعض الأنماط الظاهرية الناتجة عن نمط مورثي متخالف اللواقح (الصنوات)، حيث أنه – وفي أمثلة غير لون بذور البازلاء – نجد أنماطاً ظاهرية مشتركة بين الصنوتين الموجودتين، أي أن كلتا الصنوتين عبرتا عن نفسها، وبشكل متساوي.

إن هذا المفهوم لم يتوصل إليه ماندل، كونه اقتصر تجاربه على صفات تعتمد في ظهورها على قانون السيادة التامة – الرجحان التام.

_______________
مثال عن السيادة المشتركة – الرجحان المشترك..

الزمر الدموية ، فجميعنا نعلم بوجود أشخاص زمرتهم الدموية AB، وذلك يحصل لأن العلاقة بين المورثتين A، B هي علاقة سيادة مشتركة، حيث لا ترجح الـA على الـB ولا العكس أيضاً، وإنما تعبر كلتا الصنوتان عن نفسيهما في حال كان الفرد متخالف اللواقح نمطه الوراثي (A-B) ليكون نمطه الظاهري AB حيث تتواجد مستضدات الـA ومستضدات الـB معاً لأن الصنوتين قد عبرتا عن نفسيهما بشكل متساوي..


إن ماندل بصراحة لم يعي تماماً نتائج أبحاثه ولم يعرف أسبابها الحقيقة، ولكن لا بدَّ خلال تعلم الوراثة وأسسها أن ندرس المبادئ التي توصلَّ إليها ماندل أولاً، لأنها هي ما قادنا إلى التطور الوراثي الذي نحن عليه الآن.
______

ماهي الطبيعة الكيميائية للمورثة؟:

من الناحية الكيميائية المورثة ، هي قطعة من ADN . لذلك فإن المورثة هي حمض نووي منقوص الأكسجين مكون من سلسلتين ملتفتين حلزونيا ......

______

أين تقع المورثات؟:

تتمركز المورثات في نواة الخلية وهي محمولة على الصبغيات.
______

أين تتواجد الصبغيات؟

في نواة الخلية حقيقية النواة أو في هيولى الخلايا أولية النواة.

______

كم عدد الصبغيات في نواة خلية ما؟:

يختلف عدد الصبغيات من كائن لآخر (حسب نوع الكائن)
نوع الكائن عدد الصبغيات (خلية جسمية 2ن)
الإنسان 46
الجمل 70
الدجاج 78
الذبابة 12
ذبابة الخل 8
البعوض 6
البازلاء 14
الرز 24
الطماطم 24
الشعير 14
أقل عدد من الصبغيات وجد في أحد أنواع النمل وهو صبغي واحد وأكبر عدد وجد في نبات أحد أنواع السراخس (نبات لا زهري) وهو 630 صبغي
هل عدد الصبغيات في خلايا نفس الكائن ثابتة؟
نعم ، كل خلايا الكائن (الفرد) تحمل نفس عدد الصبغيات بل وكل خلايا النوع الواحد ماعدا في بعض الحالات المرضية.
______


كم يبلغ طول (حجم) الصبغي الواحد؟:

يختلف من صبغي لآخر.
______


كم يبلغ عدد المورثات في الصبغي الواحد؟:

يختلف من صبغي لآخر حسب حجم الصبغي (صورة للطابع النووي للإنسان ولكائن آخر)
الخلية والنواة

الطابع النووي عند الإنسان

طول الصبغي الواحد وعدد المورثات في الصبغي
عدد المورثات عدد أزواج القواعد x مليون رقم الصبغي
122 59 مليون Y

الجينوم Génome مصطلح يطلق على مجموع الصبغيات (مجموع ADN) في كائن محدد (خلية محددة).

مثال: جينوم الإنسان ، جينوم الفأر ، جينوم ذبابة الخل ، جينوم نبات القمح ....
1873 263 مليون 1 1113 255 مليون 2 302 85 مليون 18 386 50 مليون 21 501 56 مليون 22 1021 164 مليون X

ماهو حجم (طول) الجينوم في كائن ما؟
يختلف طول الجينوم حسب نوع الكائن الحي.

حجم الجينوم (في عدد ن من الصبغيات)
نوع الكائن عدد أزواج القواعد
نبات Arabidopsis 130 Mb (مليون زوج)
ذبابة الخل 180 مليون زوج
دودة خيطية 97 مليون زوج
الخميرة 12 مليون زوج
الفأر 3000 مليون زوج
الإنسان 3000 مليون زوج
Mb = Mega base أو مليون زوج من القواعد
______


كم يبلغ طول ADN في 46 صبغي عند الإنسان بوحدات الطول؟:

طول ADN في 46 صبغي هو:
طول ADN في 23 صبغي (ن)= 3000 x 610x 0.34 =1x 910 نانومتر = 1 متر
طول ADN في 46 صبغي (2ن) = 2 متر
تحتوي كل خلية إنسان على معلومات وراثية عبارة عن تتابع لـ 3 ملايير زوج من القواعد.

لو كتبت هذه المعلومات في صفحات كتاب تحتوي كل صفحة على 20 سطرا وفي كل سطر 50 حرفا فإن كل صفحة تضم 1000 حرف. ويحتوي كل كتاب (مجلد) مكون من 1000 صفحة على مليون حرف.
نحتاج لـ 3000 مجلد لكتابة كل هذه الأحرف.
لو كان سمك المجلد الواحد 10 سم فإن وضع الكتب فوق بعضها يعطينا ارتفاعا مقداره 300 متر وهو ارتفاع ناطحة سحاب.
كم عدد المورثات في نواة خلية واحدة (الجينوم)؟
يختلف عدد المورثات في الخلية الواحدة باختلاف نوع الكائن الحي. ويزداد عدد المورثات بزيادة درجة تعقيد الكائن (الوظائف والشكل).
أمثلة عن عدد المورثات في بعض الكائنات

مثال : جينوم الإنسان
حوالي 3 x 910 زوج من القواعد

عدد يتراوح بين 30 و 40 ألف مورثة

عشرات بل مئات الكائنات تم تحديد تتابع القواعد فيها (حيوانات ، نباتات ، كائنات دقيقة).
كيف يمكن تخزين هذه المعلومات بطريقة منظمة؟
كيف يمكن الوصول لهذه المعلومات بسرعة من مختلف أنحاء العالم؟
كيف يمكن تحليل هذا الكم الكبير من المعلومات بسرعة وبدقة (بدون أخطاء)؟
ماهو دور المورثة في الكائن الحي؟
1. المورثة هي قطعة من ADN تحمل معلومات وراثية لتركيب بروتين.
2. المورثة هي قطعة من ADN تحمل معلومات وراثية لتركيب سلسلة ببتيدية.
أيهما أصح؟ أيهما أدق؟


بما أن ADN يتكون من نيوكليوتيدات تختلف فيما بينها في نوع القاعدة الآزوتية (A ، C ، G ، T) فإن المعلومات الوراثية هي عبارة عن تتابع لهذه القواعد.
ATGGTGCTGTCTCCTGCCGACAAGACC
TACCACGACAGAGGACGGCTGTTCTGG
______

برنامج الهندسة الوراثية:

- عزل المادة الوراثية (الحامض النووي) (D. N .A) عن محتويات الخلية وبشكل نقي حيث أنه يمثل الحامل الحقيقي “ للمورث “ والمسئول عن تحديد الصفات الوراثية الخاصة بكل كائن حي، ومن ثم تكسير هذا المركب إلى قطع صغيرة يمكن استغلال إحداها في تغيير تركيب جيني جديد، وذلك باستعمال “ الأنزيمات المحددة “ في عملية التكسير والتجزئة ذات التسلسل القاعدي الخاص والمتطابق مع الأنزيم.
- - دمج هذه القطعة من ال(د . ن . أ) مع ربطها مع جزيء ال(د . ن . أ) الجديد الذي يعرف باسم الناقل أو الحامل، وذلك بمساعدة أنزيم خاص يعرف بالإنزيم اللاحم أو اللاصق للـ (د . ن .
أ) ينتج عن ذلك جزء:
(د . ن . أ مركب)
- ادخال هذا ال(د . ن . أ المركب) إلى الخلايا المضيفة (العائل) والتي قد تكون خلايا بكترية من خلال العملية المعروفة بالتحول، ومن ثم إتاحة الفرصة لهذا ال (د.ن.أ) المهجن للتكاثر والانقسام في البكتريا، بعدها تستخدم هذه المورثات وتحقن في الكائنات الحية الجديدة مسببة تأثيرها وقدرتها الوراثية الدالة عليها .
______

ميزات الهندسة الوراثية(الايجابيات والسلبيات):

- 1- السرعة في نقل المورثات من كائن حي إلى آخر وذلك بمرور أسابيع قليلة ومحددة بدلاً من الطريقة التقليدية والسائدة والمتعارف عليها في تغيير التركيب الجيني وباستعمال التهجين والتربية والتي تحتاج إلى سنوات طويلة.

2- نقل المورثات بطرق مباشرة ومضمونة النتائج بحيث لا تسمح بنقل المورثات غير المرغوبة التي قد تكون مرتبطة بالكروموسوم (الصبغي) والتي قد تنتقل بالطرق التقليدية مسببة لأهم مشاكل وعيوب طريقة التهجين والتربية العادية.

3- نقل المورثات بواسطة الهندسة الوراثية قضى على البعد النوعي بين الكائنات الحية، حيث يمكن نقل صفة مرغوبة من بكتريا إلى إنسان أو نبات (قمح) مثلاً أو العكس، خلاف ما هو متبع بالطرق التقليدية.

4- نقل مورثات خالية من الأمراض وذات صفات وراثية مرغوبة إلى كائنات حية جديدة تنقصها هذه الصفات.

من بعض تطبيقات الهندسة الوراثية على المجال الطبي:

يعاني الإنسان من العديد من الأمراض الوراثية الناتجة عن حدوث الطفرات الوراثية الضارة في اتحاد قواعد الحمض النووي المكون للمورث وأيضًا نتيجة لحدوث بعض الشذوذ الكروموسي في الخلية، مما يؤدي إلى خلل في فعالية البروتين المنتج والمتسبب في أعراض المرض والتي تختلف طبيعتها وشدتها اعتمادًا على نوع وطبيعة المورث الطافر. يمكن حاليًا تشخيص العديد من المورثات المسؤولة عن هذه الأمراض المحملة على الخريطة الوراثية وأيضًا دراسة التغيرات المستقبلية التي تحدث لها بواسطة تقنيات الهندسة الوراثية (PCR).

أخطار تطبيقات تقنيات الهندسة الوراثية على البيئة:

1- تزيد من فرصة تكوين المورثات المهلكة التي تشوه أو تقتل أجنة الكائنات الحية (الحيوان) في إحدى أطوار نموها المختلفة، تعمل الحكومات المتطورة في هذا المجال على سن القوانين والارشادات التي تحدد وتنظم التجارب التي تجرى في هذا المجال وتمنع إجراء هذه التجارب على الحيوانات المنوية والبويضات في الإنسان حتى لا يحدث تغييرات كثيرة في التركيب الجيني إلا أنه هناك خوف كبير يتبادر إلى المجتمعات وهو أنه فيما إذا طبقت أساليب الهندسة الوراثية على الإنسان فإن النتائج سوف لا تحمد عقباها.

2- إنتاج (أنواع - سلالات) جديدة من الكائنات الحية الدقيقة والمسببة لكثير من الأمراض ذات أشكال ظاهرية وخواص بيولوجية جديدة تزيد من سرعة انتشارها في الطبيعة بالإضافة إلى عدم وجود أعداء طبيعيين ومضادات حيوية لها في الوقت الحاضر مما يحدث عدم التوازن بين الكائنات الحية في الطبيعة.

3-إنتاج (سلالات) جديدة من بعض أنواع البكتريا E-coli نتيجة إحداث تغير في التركيب الجيني لها والتي تحمل مورثات خطيرة يمكن أن تتسرب من المعامل إلى الطبيعة وتسبب أمراضًا.

4- رش الحقول ببعض البكتريا المعدلة وراثيًا قد يحدث تأثيرات عكسية ذات أضرار كبيرة على البيئة خصوصًا مصادر المياه محدثة أثارًا سلبية على البيئة وصحة المجتمع.

5- الكثير من العلماء المهتمين بعلوم البيئة لديهم تخوف من أن انتشار كائنات حية دقيقة أجرى عليها تغيير في التركيب الوراثي من شأنه أن يغير من النظام البيئي. 6- بالإمكان حاليًا هندسة بعض أنواع من البكتريا القادرة على التكاثر بسرعة كبيرة وإنتاج مواد سامة (Toxins) بكميات هائلة يمكن استخدامها في الحروب البيولوجية لإبادة البشرية.
______

طيب، كيف تتواجد المورثات فيجسم الكائن؟ وأين؟ ووفق أي تراتبية؟:

الصيغة الصبغية :

إن مفهوم الصيغة الصبغية يعتمد على الكائن الحي المدروس، ولنأخذ الإنسان على سبيل المثال، فهو يملك في كل خلية (46)

لذا، فإن الصبغي (6) مثلاً موجود بنسختين إحداهما من الأب والأخرى من الأم، لذا فإن "أي" مورثة موجودة على ذلك الصبغي هي عبارة عن نسختين أحدهما من الأب والأخرى من الأم.

إن كل ما سبق، يوجهنا نحو مفهوم الصيغة الصبغية المضاعفة Diploid لدى الكائن الحي.
و لتتحقق الصيغة المضاعفة تلك ،لا بد وأن تكون الصيغة الصبغية في كل من النطفة والبويضة مفردة Haploid، وذلك للحصول على الصيغة المضاعفة عند التقاء النطفة والبويضة لتشكيل البيضة الملقحة.

إن كل تلك المعلومات -كما ذكرت- تتباين بحسب الكائن المدروس، ففي الإنسان ومعظم الكائنات العليا يكون الفرد الكامل مضاعف الصيغة الصبغية، أما العروس (أي النطفة والبويضة) تملك صيغة صبغية مفردة.

لكن الوضع يختلف في باقي الكائنات، فإذا أخذنا الأشنيات على سبيل المثال، فالكائن الكامل لديها مفرد الصيغة الصبغية، أما الأبواغ (أي الجيل العروسي) فتكون مضاعفة الصيغة الصبغية.

يختلف الأمر أيضاً لدى البكتيريا، حيث أنها مفردة الصيغة الصبغية دوماً، وتلجأ للانقسامات الفتيلية (الخيطية) Mitosis من أجل التكاثر، دون اللجوء إلى الانقسامات المنصفة meiosis ولا حتى لآلية صناعة الأعراس.

ولاحظنا فيما سبق أن الكائن الحي يتكاثر "بمفرده" أي انه يملك كل المقومات التي تخوله للقيام بالتكاثر، ولكن الفيروسات Viruses لا تملك تلك الإمكانية. وبغض النظر عن صيغتها الصبغية وماهية المادة الوراثية فيها، فإن الفيروسات مجبرة على البحث عم كائن مضيف Host تستجر منه المواد اللازمة لتتكاثر.
______

كيف يتم التعبير عن المورثة :

النمط الظاهري Phenotype : مجموعة الخصائص والصفات المشاهَدة لدى أي كائن حي، أو بعبارة أخرى الخصائص التي يمكن قياسها.

النمط المورثي Genotype : العوامل المورثية (الرموز) المسؤولة عن إظهار النمط الظاهري.

إذاً، لكل كائن حي مجموعة من الصفات والخصائص، يتفرد ببعضها عن كل أبناء جنسه، وبعضها الآخر مشترك بينه وبين باقي أفراد المجموعة الواحدة. وكل تلك الصفات تظهر وفق عمليات ترجمة منظمة لرموز تدعى بـ "المورثات Genes" المحمولة على بنىً تدعى بـ"الصبغيات Chromosomes".

السؤال الذي يطرح نفسه هنا:
كيف تُتَرجم المورثة إلى صفة ظاهرة؟:

إن تلك العملية معقدة جداً، يدخل فيها العديد من الوسائط.. سنتحدث بالتفصيل عن تلك العملية لاحقاً.
ولكن ما يهمنا الآن هو ما يلي : يكون النمط الظاهري آخر نتيجة يحصل عليها الجسم بعد الكثير من العمليات الاستقلابية التي تلي تفكيك رموز المورثات.



ومن الجدير بالذكر، أن كل صفة من صفات الكائن الحي لها تفرد وخصوصية في آلية ظهورها والعوامل المساهمة في تلك العملية، فبعض الصفات مثلاً تحتاج لمورثة واحد فقط تترجم فتظهر الصفة، ولكن البعض الآخر من الصفات تحتاج إلى أكثر من مورثة تترجم وفق تسلسل معين تظهر الصفة من خلاله.


ماهو طول (حجم) المورثة الواحدة؟

يختلف حسب حجم البروتين المراد تركيبه (عدد الأحماض الأمينية في السلسلة الببتيدية).
كل حمض أميني يقابله 3 قواعد آزوتية على ARNm وكذلك على ADN .

_______________

ماهي العوامل التي قد تغير من المورثة(تغيير النمط الظاهري):

حسناً، ولو كانت المورثات ثابتة منذ بدء الزمن، لما حصلنا على اختلافات بين البشر أبداً،، ما هي العوامل التي قد تغير من المورثة، وبالتالي قد يتغير النمط الظاهري كنتيجة لذلك؟

الطفرات Mutations :

إن المورثة "قد" تعتبر كياناً ثابتاً تنتقل من جيل لآخر عبر التكاثر وعمليات الانقسام الخلوي، ويتحكم في انتقالها نظام عالي الدقة يمنع حدوث أي خطأ.
لكن في بعض الأحيان قد تتعرض المورثة إلى تغيير مفاجئ في أحد بناها "الأساسية" مؤدياً إلى اختلاف النمط الظاهري الناتج عن ترجمة تلك المورثة.

و يتراوح الأثر الناجم عن الطفرة ما بين "غير الملحوظ Undetectable" و"القاتل Lethal"، ولا بد أن نعلم أن الطفرة عبارة عن تعديل ضئيل جداً في إحدى المورثات قد ينجم عنه اختلال كبير جداً في شكل الكائن الحي أو أحد وظائفه.

لذا فإن ذلك يخلق لدينا دراية تامة بأنه إذا كانت المورثة تنتقل من جيل لآخر، فبالتالي ستنتقل الطفرة (وأثرها) من الجيل التي حدثت فيه إلى الجيل التالي.

مثال : بيلة الفينيل كيتون Phenylketonuria :بيلة الفينيل كيتون هي مرض ناتج عن اختلال وراثي )طفرة) ينجم عنهُ غياب الأنزيم المسؤول عن تحويل الحمض الأميني الفينيل ألانينن Phynylalanine إلى الحمض الأميني التيروزين Tyrosine.و ينجم عن ذلك تراكم الفينيل ألانين والعديد من السموم التي تؤثر سلباً على صحة المصاب.
ما يهمنا من المثال هو عرض أثر ظاهري خطير ناتج عن طفرة صغيرة جداً.
______

كيف نقيس طول المورثة؟:

بعدد أزواج القواعد bp (base pair) .
أو بالطول العادي (سم ، ملم ، ميكرون ، نانومتر.....)
كل زوج قواعد (زوج من النيوكليوتيدات) يساوي 0.34 نانومتر.

هل يساوي طول المورثة عدد الأحماض الأمينية في البروتين x 3 ؟
طول المورثة أكبر بكثير من عدد الأحماض الأمينية x 3 .
إذا كان طول المورثة أكبر بكثير من عدد أ أ x 3 . فماهو دور الأجزاء الأخرى التي لا تؤدي إلى تركيب بروتين (لا تعبر عن أحماض أمينية)؟

تحتوي المورثة على مناطق إضافية لا تحمل معلومات وراثية لتركيب بروتين .

أين تقع هذه المناطق؟
ماهو حجمها (طولها)؟
ماهو دورها؟

يمكن تقسيم هذه المناطق إلى :

1. مناطق لا تستنسخ (موجودة فقط على ADN داخل أو خارج المورثات) تسمى هذه المنطقة بالمنطقة المفتوحة للقراءة ORF(Open Reading Frame)
Phase Ouverte de Lecture
2. مناطق تستنسخ وتنزع بعد الإستنساخ عند حقيقيات النواة (مناطق غير دالة Introns) . هذه المناطق لا نجدها على ARNm الناضج ولا نجدها على ADNc المكمل.

3. مناطق تستنسخ ولا تنزع بعد الاستنساخ لكنها لا تترجم . هذه المناطق تقع في بداية ونهاية قطعة ARNm الناضج.

4. مناطق تستنسخ وتترجم: وهي المنطقة المستمرة الواقعة بين رامزة الانطلاق ورامزة التوقف. طول هذه المنطقة يساوي عدد الأحماض الأمينية x 3 + 3 .

هل يتم استنساخ كل النيوكليوتيدات الموجودة في المورثة؟ لا
كيف يمكننا التأكد من الإجابة؟
مقارنة طول المورثة الأصلية على ADN وطول ARN الأولي (ما قبل الرسول pré-messager).

هل يتم ترجمة كل المعلومات المستنسخة؟ لا
كيف يمكننا التأكد من الإجابة؟
مقارنة طول المعلومات القابلة للترجمة (عدد أ ا x 3+3) مع طول ARN الأولي.
مقارنة طول المعلومات القابلة للترجمة (عدد أ ا x 3+3) مع طول ARNm الناضج.
ADN المكمل

ADN المكمل (ADNc) أو ADN complémentaire :

هو ADN يتم الحصول عليه انطلاق من استنساخ عكسي لـ ARNm الناضج القابل للترجمة.
مافائدته؟
يستعمل عند نقل مورثة من كائنات حقيقية النواة إلى كائنات أولية النواة.
ماهي المعلومات التي يحتويها ADNc ؟
المعلومات المكملة لـ ARNm الناضح.

إشكالية

1. حجم المعلومات الوراثية لأي كائن حي كبير جدا.
2. تطور العلوم مكن العلماء من تحديد هذه المعلومات في عدد كبير من الكائنات الحية ومن اهمها الإنسان.
3. تراكم لدى الباحثين كم كبير من المعلومات الهامة يجب الإستفادة منها واستغلالها أحسن استغلال.
4. هذه المعلومات مفيدة في البحث وفي التعليم نظرا لأهميتها في توضيح العديد من المفاهيم التي بقيت مبهمة والإجابة على العديد من الأسئلة التي طرحناها سابقا.
5. كيف يمكن تنظيم هذه المعلومات ، تسهيل استغلالها بطريقة علمية دقيقة ، تسهيل الوصول إليها من مختلف انحاء العالم مهما كان المكان التي تم فيه الإكتشاف؟

الجواب على الإشكالية

1. إنشاء بنوك للمعلومات على الحاسوب (الكمبيوتر)
2. تصميم برامج كمبيوتر لمعالجة وتحليل هذه المعلومات بسرعة وبدقة
3. وضع هذه البنوك على شبكة الإنترنت لكي يسهل الوصول إليها من مختلف انحاء العالم.
4. وضع البرامج على شبكة الإنترنت حتى يتسنى تحميلها واستعمالها
5. كل باحث يكتشف تتابع مورثة أو جينوم يخزنه في البنك في صورة منظمة متفق عليها سلفا.
______

الخاتمة:

تعتبر الهندسة الوراثية سلاحًا ذا حدين . لذا يجب التعرف على أهميتها وكيفية استغلالها فيما يعود بالنفع على الإنسان أو حماية البيئة من التلوث وغيرها. وفي الختام نود أن يستخدم العلماء الهندسة الوراثية لتحسين ظروف الحياة في كل مجالاتها والاستفادة بقدر الإمكان من مميزاتها وتطبيقاتها الآمنة . وآمل أن يكون بحثي قد ألم بما هو مفيد .


الرجوع الى أعلى الصفحة اذهب الى الأسفل
معاينة صفحة البيانات الشخصي للعضو http://egytoday.123.st
 

مفهوم البرنامج الوراثي والمورثة

استعرض الموضوع السابق استعرض الموضوع التالي الرجوع الى أعلى الصفحة 
صفحة 1 من اصل 1

خدمات الموضوع
 KonuEtiketleri كلمات دليليه
مفهوم البرنامج الوراثي والمورثة , مفهوم البرنامج الوراثي والمورثة , مفهوم البرنامج الوراثي والمورثة ,مفهوم البرنامج الوراثي والمورثة ,مفهوم البرنامج الوراثي والمورثة , مفهوم البرنامج الوراثي والمورثة
 KonuLinki رابط الموضوع
 Konu BBCode BBCode
 KonuHTML Kodu HTMLcode
إذا وجدت وصلات لاتعمل في الموضوع او أن الموضوع [ مفهوم البرنامج الوراثي والمورثة ] مخالف ,, من فضلك راسل الإدارة من هنا
صلاحيات هذا المنتدى:لاتستطيع الرد على المواضيع في هذا المنتدى
 :: قسم الاسرة :: منتدى التعليم-
سحابة الكلمات الدلالية
الثانية الهندي الجزائرية السنة تحضير وفلسفة الفصل 2014 الثالثة فلسفية مسابقة حلويات اداب الرابعة الرياضيات متوسط وفوائده الفطر تحميل تمارين للسنة التاريخ ابتدائي جزائرية اختبارات ثانوي
انضم الى معجبينا الفايسبوك

Hao123